UU&uENү<62bzG(*MpBEҲ$2g8STXp}+ *O͔Ŕ?cKBpBsqIO[c^zBڦZnt23ҊԻH#/&%3Vq݀P,:˘I;_3U}O 4Tdހw6͖Ρ #mY
癏C%Ӆ[0[-NE h M2Bff&(m?r{G!/!ӿW zy4 r{wNꆱ $,Ѩ)cQKode !rL8z(p8z".$c㓷÷ O/,
{ξ|Ώb0 4Sl>
NIWeMD
jCaU3Cޒ8
`48 -\h ˁ
Z;D/`b>8eo4$u lJcdIZ@Fz&0ޓ>\n 咎v@#2G>'TЀ+ن~&Zͳ"lk"xf#^է`ae b҂n!di0'J>Fn3\ĵv- ?7V6"'1y"X^T BOa:]q 9isu@-DxZN[Nu
v"eEaҶKN%:R* rhXӜ 1f%b`PғAն̹T 3PtYNj!nDtdVƁ:v(K۲ ( vwZw{|h \z$4 c#&NE _ pS| p SWkMqK z0pX`(B~ LII0xTdj
VPv
6
uGݩ-~d!A 1Gi nn(6#N"zȢU7p8:L??GWcsH dWss> < /.8< /HwOG,Qt-V"UaakaFmr`HR^_VvXynPtv?FG<(& D 윛H4AOSw_Fw}s }3^[m'11A$MUY~Jkt|5쭶t"ɞ Enǒfl=CڼС=5eqDeid7BD XCҦ~2 F^\Z+M 9ZO !@Iưy5Y
s;j?_ -dlV¶d|kd:ꦂ)i֮KnazΎTg H/h!;
6/k.H1 FjN 9//"Q1BI w.pʀZZ#-N_i)2'r;T^T.j?P :+wF%A}[ \7I=Q;`,`1/h! RDZv#ʡ
qɧؔT+_©ߏ 1Сl;ErMYÞvNN\i >q|g*b_x-a|Qb2B `- Å۶Ko e[ z) U}e 'v%r.d^ 88c\a%
_Xm1w$ ڠ}Hvz$tE
0DbN~jiNShn2aFxl}ARyrѸxg)ZşI۹O [H\m%B;&쇷 dOY^p'8S-:+ ڨw EұD=R,'XʆR4k[=%||$b!ȇ50Ki`!8\a22¹;~g~Ù|>p<NF]dn1"aR+)+
He : k58:#9S_;W?<`'*H6Ea05*W<;nM;9|Aw 1@("OkZ*4H' H]}QFL
b$'ukv+sc{x뽤c֍_q PYCl\HTY
Ha-S ѪYu;Xf ƴp$pR"u\0䏵Rpgac4Iu )Uh
\ȱ/_ pp _x x? 玿 qH4Ayp
Nep:PܷqS Rl"%%61\z=J;m[d_>F d|s;\)Nnң t2O9W^,wi?.ye|T/] _&dz zro|#\i{UPD&M-ޥ1_T36pjuw Wݯ5 '<TjJ+M my-small.cnf 0000666 00000004615 15100047631 0006776 0 ustar 00 # Example MySQL config file for small systems.
#
# This is for a system with little memory (<= 64M) where MySQL is only used
# from time to time and it's important that the mysqld daemon
# doesn't use much resources.
#
# MySQL programs look for option files in a set of
# locations which depend on the deployment platform.
# You can copy this option file to one of those
# locations. For information about these locations, see:
# http://dev.mysql.com/doc/mysql/en/option-files.html
#
# In this file, you can use all long options that a program supports.
# If you want to know which options a program supports, run the program
# with the "--help" option.
# The following options will be passed to all MySQL clients
[client]
#password = your_password
port = 3306
socket = /var/run/mysqld/mysqld.sock
# Here follows entries for some specific programs
# The MySQL server
[mysqld]
port = 3306
socket = /var/run/mysqld/mysqld.sock
skip-locking
key_buffer_size = 16K
max_allowed_packet = 1M
table_open_cache = 4
sort_buffer_size = 64K
read_buffer_size = 256K
read_rnd_buffer_size = 256K
net_buffer_length = 2K
thread_stack = 128K
# Don't listen on a TCP/IP port at all. This can be a security enhancement,
# if all processes that need to connect to mysqld run on the same host.
# All interaction with mysqld must be made via Unix sockets or named pipes.
# Note that using this option without enabling named pipes on Windows
# (using the "enable-named-pipe" option) will render mysqld useless!
#
#skip-networking
server-id = 1
# Uncomment the following if you want to log updates
#log-bin=mysql-bin
# binary logging format - mixed recommended
#binlog_format=mixed
# Uncomment the following if you are using InnoDB tables
#innodb_data_home_dir = /var/lib/mysql
#innodb_data_file_path = ibdata1:10M:autoextend
#innodb_log_group_home_dir = /var/lib/mysql
# You can set .._buffer_pool_size up to 50 - 80 %
# of RAM but beware of setting memory usage too high
#innodb_buffer_pool_size = 16M
#innodb_additional_mem_pool_size = 2M
# Set .._log_file_size to 25 % of buffer pool size
#innodb_log_file_size = 5M
#innodb_log_buffer_size = 8M
#innodb_flush_log_at_trx_commit = 1
#innodb_lock_wait_timeout = 50
[mysqldump]
quick
max_allowed_packet = 16M
[mysql]
no-auto-rehash
# Remove the next comment character if you are not familiar with SQL
#safe-updates
[myisamchk]
key_buffer_size = 8M
sort_buffer_size = 8M
[mysqlhotcopy]
interactive-timeout
my-medium.cnf.gz 0000666 00000004017 15100047631 0007561 0 ustar 00 XO#7W+ ) $-+vKTșq2.3!~&NH>~f?$ͷrWjM+TB5vl/ۣR9/EK8X- iL燴)l4:TG
yCٛam, 0fmN 6/I88KrK{ONt1w!xet iMz2+ L.xl.Ұ*%GQ ]5E6-17rp|`c3ZB=C#(͊
i=rQl7gGG[>*L~ I}
ChUHG m. N ; k>
AiIY??7"ܥ oRVͷ$ c8V٨W?P"\Dp<R( n=[|sE=cWǧ3 _=1E3avc2%%Fj g]ѻ쏨qݩf 0!#ٝ.j%©H:(-: W1Ʌ5t pJ\ PZ*-@YK`VY跏J2Ȍ!~ Hr&j Vjv E87j
o$ 3ŝRW3(B6UC\c..gg3^Z:;\ 65.8xwKOSw]{I1\ P4 A0rtcڸ JU?Ru^\ ]Ѓj
GgA>S~p?\{:XUE\n!?3ڋd.j3 Q
koGt|/z8p 8="ԙ N-Ez%QOt%8X}FϜ]L:'b:;LgnJ 1WF \ !3:<Ʊ qo@W`hż1j1T ja-aRKK ɀG+*nߨ+h ^:)
6Oh0lRb-x? qSdo b?k6L>= RkUQ Fp҇_
P5!+l=h]Z,fUxtb % )~L$[k [
fB8LB90z/#}gOiNʚz'D>{+Ǵ8|'q?_F ?wl 64 /QE>mWbR-7tx:&^-E prog/wordfreq.awk 0000666 00000000646 15100053302 0010047 0 ustar 00 # wordfreq.awk --- print list of word frequencies
{
$0 = tolower($0) # remove case distinctions
# remove punctuation
gsub(/[^[:alnum:]_[:blank:]]/, "", $0)
for (i = 1; i <= NF; i++)
freq[$i]++
}
END {
for (word in freq)
printf "%s\t%d\n", word, freq[word]
}
END {
sort = "sort -k 2nr"
for (word in freq)
printf "%s\t%d\n", word, freq[word] | sort
close(sort)
}
prog/alarm.awk 0000666 00000004421 15100053302 0007305 0 ustar 00 # alarm.awk --- set an alarm
#
# Requires gettimeofday library function
#
# Arnold Robbins, arnold@skeeve.com, Public Domain
# May 1993
# usage: alarm time [ "message" [ count [ delay ] ] ]
BEGIN \
{
# Initial argument sanity checking
usage1 = "usage: alarm time ['message' [count [delay]]]"
usage2 = sprintf("\t(%s) time ::= hh:mm", ARGV[1])
if (ARGC < 2) {
print usage1 > "/dev/stderr"
print usage2 > "/dev/stderr"
exit 1
} else if (ARGC == 5) {
delay = ARGV[4] + 0
count = ARGV[3] + 0
message = ARGV[2]
} else if (ARGC == 4) {
count = ARGV[3] + 0
message = ARGV[2]
} else if (ARGC == 3) {
message = ARGV[2]
} else if (ARGV[1] !~ /[0-9]?[0-9]:[0-9][0-9]/) {
print usage1 > "/dev/stderr"
print usage2 > "/dev/stderr"
exit 1
}
# set defaults for once we reach the desired time
if (delay == 0)
delay = 180 # 3 minutes
if (count == 0)
count = 5
if (message == "")
message = sprintf("\aIt is now %s!\a", ARGV[1])
else if (index(message, "\a") == 0)
message = "\a" message "\a"
# split up alarm time
split(ARGV[1], atime, ":")
hour = atime[1] + 0 # force numeric
minute = atime[2] + 0 # force numeric
# get current broken down time
gettimeofday(now)
# if time given is 12-hour hours and it's after that
# hour, e.g., `alarm 5:30' at 9 a.m. means 5:30 p.m.,
# then add 12 to real hour
if (hour < 12 && now["hour"] > hour)
hour += 12
# set target time in seconds since midnight
target = (hour * 60 * 60) + (minute * 60)
# get current time in seconds since midnight
current = (now["hour"] * 60 * 60) + \
(now["minute"] * 60) + now["second"]
# how long to sleep for
naptime = target - current
if (naptime <= 0) {
print "time is in the past!" > "/dev/stderr"
exit 1
}
# zzzzzz..... go away if interrupted
if (system(sprintf("sleep %d", naptime)) != 0)
exit 1
# time to notify!
command = sprintf("sleep %d", delay)
for (i = 1; i <= count; i++) {
print message
# if sleep command interrupted, go away
if (system(command) != 0)
break
}
exit 0
}
prog/split.awk 0000666 00000002207 15100053302 0007344 0 ustar 00 # split.awk --- do split in awk
#
# Requires ord and chr library functions
#
# Arnold Robbins, arnold@skeeve.com, Public Domain
# May 1993
# usage: split [-num] [file] [outname]
BEGIN {
outfile = "x" # default
count = 1000
if (ARGC > 4)
usage()
i = 1
if (ARGV[i] ~ /^-[0-9]+$/) {
count = -ARGV[i]
ARGV[i] = ""
i++
}
# test argv in case reading from stdin instead of file
if (i in ARGV)
i++ # skip data file name
if (i in ARGV) {
outfile = ARGV[i]
ARGV[i] = ""
}
s1 = s2 = "a"
out = (outfile s1 s2)
}
{
if (++tcount > count) {
close(out)
if (s2 == "z") {
if (s1 == "z") {
printf("split: %s is too large to split\n",
FILENAME) > "/dev/stderr"
exit 1
}
s1 = chr(ord(s1) + 1)
s2 = "a"
}
else
s2 = chr(ord(s2) + 1)
out = (outfile s1 s2)
tcount = 1
}
print > out
}
function usage( e)
{
e = "usage: split [-num] [file] [outname]"
print e > "/dev/stderr"
exit 1
}
prog/wc.awk 0000666 00000002704 15100053302 0006624 0 ustar 00 # wc.awk --- count lines, words, characters
#
# Arnold Robbins, arnold@skeeve.com, Public Domain
# May 1993
# Options:
# -l only count lines
# -w only count words
# -c only count characters
#
# Default is to count lines, words, characters
#
# Requires getopt and file transition library functions
BEGIN {
# let getopt print a message about
# invalid options. we ignore them
while ((c = getopt(ARGC, ARGV, "lwc")) != -1) {
if (c == "l")
do_lines = 1
else if (c == "w")
do_words = 1
else if (c == "c")
do_chars = 1
}
for (i = 1; i < Optind; i++)
ARGV[i] = ""
# if no options, do all
if (! do_lines && ! do_words && ! do_chars)
do_lines = do_words = do_chars = 1
print_total = (ARGC - i > 2)
}
function beginfile(file)
{
chars = lines = words = 0
fname = FILENAME
}
function endfile(file)
{
tchars += chars
tlines += lines
twords += words
if (do_lines)
printf "\t%d", lines
if (do_words)
printf "\t%d", words
if (do_chars)
printf "\t%d", chars
printf "\t%s\n", fname
}
# do per line
{
chars += length($0) + 1 # get newline
lines++
words += NF
}
END {
if (print_total) {
if (do_lines)
printf "\t%d", tlines
if (do_words)
printf "\t%d", twords
if (do_chars)
printf "\t%d", tchars
print "\ttotal"
}
}
prog/guide.awk 0000666 00000000245 15100053302 0007306 0 ustar 00 BEGIN {
TEXTDOMAIN = "guide"
bindtextdomain(".") # for testing
print _"Don't Panic"
print _"The Answer Is", 42
print "Pardon me, Zaphod who?"
}
prog/tee.awk 0000666 00000001256 15100053302 0006771 0 ustar 00 # tee.awk --- tee in awk
#
# Arnold Robbins, arnold@skeeve.com, Public Domain
# May 1993
# Revised December 1995
BEGIN \
{
for (i = 1; i < ARGC; i++)
copy[i] = ARGV[i]
if (ARGV[1] == "-a") {
append = 1
delete ARGV[1]
delete copy[1]
ARGC--
}
if (ARGC < 2) {
print "usage: tee [-a] file ..." > "/dev/stderr"
exit 1
}
ARGV[1] = "-"
ARGC = 2
}
{
# moving the if outside the loop makes it run faster
if (append)
for (i in copy)
print >> copy[i]
else
for (i in copy)
print > copy[i]
print
}
END \
{
for (i in copy)
close(copy[i])
}
prog/awksed.awk 0000666 00000001003 15100053302 0007460 0 ustar 00 # awksed.awk --- do s/foo/bar/g using just print
# Thanks to Michael Brennan for the idea
#
# Arnold Robbins, arnold@skeeve.com, Public Domain
# August 1995
function usage()
{
print "usage: awksed pat repl [files...]" > "/dev/stderr"
exit 1
}
BEGIN {
# validate arguments
if (ARGC < 3)
usage()
RS = ARGV[1]
ORS = ARGV[2]
# don't use arguments as files
ARGV[1] = ARGV[2] = ""
}
# look ma, no hands!
{
if (RT == "")
printf "%s", $0
else
print
}
prog/igawk.sh 0000666 00000006023 15100053302 0007143 0 ustar 00 #! /bin/sh
# igawk --- like gawk but do @include processing
#
# Arnold Robbins, arnold@skeeve.com, Public Domain
# July 1993
if [ "$1" = debug ]
then
set -x
shift
fi
# A literal newline, so that program text is formatted correctly
n='
'
# Initialize variables to empty
program=
opts=
while [ $# -ne 0 ] # loop over arguments
do
case $1 in
--) shift; break;;
-W) shift
# The ${x?'message here'} construct prints a
# diagnostic if $x is the null string
set -- -W"${@?'missing operand'}"
continue;;
-[vF]) opts="$opts $1 '${2?'missing operand'}'"
shift;;
-[vF]*) opts="$opts '$1'" ;;
-f) program="$program$n@include ${2?'missing operand'}"
shift;;
-f*) f=`expr "$1" : '-f\(.*\)'`
program="$program$n@include $f";;
-[W-]file=*)
f=`expr "$1" : '-.file=\(.*\)'`
program="$program$n@include $f";;
-[W-]file)
program="$program$n@include ${2?'missing operand'}"
shift;;
-[W-]source=*)
t=`expr "$1" : '-.source=\(.*\)'`
program="$program$n$t";;
-[W-]source)
program="$program$n${2?'missing operand'}"
shift;;
-[W-]version)
echo igawk: version 2.0 1>&2
gawk --version
exit 0 ;;
-[W-]*) opts="$opts '$1'" ;;
*) break;;
esac
shift
done
if [ -z "$program" ]
then
program=${1?'missing program'}
shift
fi
# At this point, `program' has the program.
expand_prog='
function pathto(file, i, t, junk)
{
if (index(file, "/") != 0)
return file
for (i = 1; i <= ndirs; i++) {
t = (pathlist[i] "/" file)
if ((getline junk < t) > 0) {
# found it
close(t)
return t
}
}
return ""
}
BEGIN {
path = ENVIRON["AWKPATH"]
ndirs = split(path, pathlist, ":")
for (i = 1; i <= ndirs; i++) {
if (pathlist[i] == "")
pathlist[i] = "."
}
stackptr = 0
input[stackptr] = ARGV[1] # ARGV[1] is first file
for (; stackptr >= 0; stackptr--) {
while ((getline < input[stackptr]) > 0) {
if (tolower($1) != "@include") {
print
continue
}
fpath = pathto($2)
if (fpath == "") {
printf("igawk:%s:%d: cannot find %s\n",
input[stackptr], FNR, $2) > "/dev/stderr"
continue
}
if (! (fpath in processed)) {
processed[fpath] = input[stackptr]
input[++stackptr] = fpath # push onto stack
} else
print $2, "included in", input[stackptr],
"already included in",
processed[fpath] > "/dev/stderr"
}
close(input[stackptr])
}
}' # close quote ends `expand_prog' variable
processed_program=`gawk -- "$expand_prog" /dev/stdin < "/dev/stderr"
exit 1
}
# -c count lines. overrides -d and -u
# -d only repeated lines
# -u only non-repeated lines
# -n skip n fields
# +n skip n characters, skip fields first
BEGIN \
{
count = 1
outputfile = "/dev/stdout"
opts = "udc0:1:2:3:4:5:6:7:8:9:"
while ((c = getopt(ARGC, ARGV, opts)) != -1) {
if (c == "u")
non_repeated_only++
else if (c == "d")
repeated_only++
else if (c == "c")
do_count++
else if (index("0123456789", c) != 0) {
# getopt requires args to options
# this messes us up for things like -5
if (Optarg ~ /^[0-9]+$/)
fcount = (c Optarg) + 0
else {
fcount = c + 0
Optind--
}
} else
usage()
}
if (ARGV[Optind] ~ /^\+[0-9]+$/) {
charcount = substr(ARGV[Optind], 2) + 0
Optind++
}
for (i = 1; i < Optind; i++)
ARGV[i] = ""
if (repeated_only == 0 && non_repeated_only == 0)
repeated_only = non_repeated_only = 1
if (ARGC - Optind == 2) {
outputfile = ARGV[ARGC - 1]
ARGV[ARGC - 1] = ""
}
}
function are_equal( n, m, clast, cline, alast, aline)
{
if (fcount == 0 && charcount == 0)
return (last == $0)
if (fcount > 0) {
n = split(last, alast)
m = split($0, aline)
clast = join(alast, fcount+1, n)
cline = join(aline, fcount+1, m)
} else {
clast = last
cline = $0
}
if (charcount) {
clast = substr(clast, charcount + 1)
cline = substr(cline, charcount + 1)
}
return (clast == cline)
}
NR == 1 {
last = $0
next
}
{
equal = are_equal()
if (do_count) { # overrides -d and -u
if (equal)
count++
else {
printf("%4d %s\n", count, last) > outputfile
last = $0
count = 1 # reset
}
next
}
if (equal)
count++
else {
if ((repeated_only && count > 1) ||
(non_repeated_only && count == 1))
print last > outputfile
last = $0
count = 1
}
}
END {
if (do_count)
printf("%4d %s\n", count, last) > outputfile
else if ((repeated_only && count > 1) ||
(non_repeated_only && count == 1))
print last > outputfile
}
prog/testbits.awk 0000666 00000001331 15100053302 0010047 0 ustar 00 # bits2str --- turn a byte into readable 1's and 0's
function bits2str(bits, data, mask)
{
if (bits == 0)
return "0"
mask = 1
for (; bits != 0; bits = rshift(bits, 1))
data = (and(bits, mask) ? "1" : "0") data
while ((length(data) % 8) != 0)
data = "0" data
return data
}
BEGIN {
printf "123 = %s\n", bits2str(123)
printf "0123 = %s\n", bits2str(0123)
printf "0x99 = %s\n", bits2str(0x99)
comp = compl(0x99)
printf "compl(0x99) = %#x = %s\n", comp, bits2str(comp)
shift = lshift(0x99, 2)
printf "lshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift)
shift = rshift(0x99, 2)
printf "rshift(0x99, 2) = %#x = %s\n", shift, bits2str(shift)
}
prog/labels.awk 0000666 00000001767 15100053302 0007465 0 ustar 00 # labels.awk --- print mailing labels
#
# Arnold Robbins, arnold@skeeve.com, Public Domain
# June 1992
# Each label is 5 lines of data that may have blank lines.
# The label sheets have 2 blank lines at the top and 2 at
# the bottom.
BEGIN { RS = "" ; MAXLINES = 100 }
function printpage( i, j)
{
if (Nlines <= 0)
return
printf "\n\n" # header
for (i = 1; i <= Nlines; i += 10) {
if (i == 21 || i == 61)
print ""
for (j = 0; j < 5; j++) {
if (i + j > MAXLINES)
break
printf " %-41s %s\n", line[i+j], line[i+j+5]
}
print ""
}
printf "\n\n" # footer
for (i in line)
line[i] = ""
}
# main rule
{
if (Count >= 20) {
printpage()
Count = 0
Nlines = 0
}
n = split($0, a, "\n")
for (i = 1; i <= n; i++)
line[++Nlines] = a[i]
for (; i <= 5; i++)
line[++Nlines] = ""
Count++
}
END \
{
printpage()
}
prog/egrep.awk 0000666 00000003664 15100053302 0007323 0 ustar 00 # egrep.awk --- simulate egrep in awk
#
# Arnold Robbins, arnold@skeeve.com, Public Domain
# May 1993
# Options:
# -c count of lines
# -s silent - use exit value
# -v invert test, success if no match
# -i ignore case
# -l print filenames only
# -e argument is pattern
#
# Requires getopt and file transition library functions
BEGIN {
while ((c = getopt(ARGC, ARGV, "ce:svil")) != -1) {
if (c == "c")
count_only++
else if (c == "s")
no_print++
else if (c == "v")
invert++
else if (c == "i")
IGNORECASE = 1
else if (c == "l")
filenames_only++
else if (c == "e")
pattern = Optarg
else
usage()
}
if (pattern == "")
pattern = ARGV[Optind++]
for (i = 1; i < Optind; i++)
ARGV[i] = ""
if (Optind >= ARGC) {
ARGV[1] = "-"
ARGC = 2
} else if (ARGC - Optind > 1)
do_filenames++
# if (IGNORECASE)
# pattern = tolower(pattern)
}
#{
# if (IGNORECASE)
# $0 = tolower($0)
#}
function beginfile(junk)
{
fcount = 0
}
function endfile(file)
{
if (! no_print && count_only)
if (do_filenames)
print file ":" fcount
else
print fcount
total += fcount
}
{
matches = ($0 ~ pattern)
if (invert)
matches = ! matches
fcount += matches # 1 or 0
if (! matches)
next
if (! count_only) {
if (no_print)
nextfile
if (filenames_only) {
print FILENAME
nextfile
}
if (do_filenames)
print FILENAME ":" $0
else
print
}
}
END \
{
if (total == 0)
exit 1
exit 0
}
function usage( e)
{
e = "Usage: egrep [-csvil] [-e pat] [files ...]"
e = e "\n\tegrep [-csvil] pat [files ...]"
print e > "/dev/stderr"
exit 1
}
prog/cut.awk 0000666 00000007130 15100053302 0007004 0 ustar 00 # cut.awk --- implement cut in awk
#
# Arnold Robbins, arnold@skeeve.com, Public Domain
# May 1993
# Options:
# -f list Cut fields
# -d c Field delimiter character
# -c list Cut characters
#
# -s Suppress lines without the delimiter
#
# Requires getopt and join library functions
function usage( e1, e2)
{
e1 = "usage: cut [-f list] [-d c] [-s] [files...]"
e2 = "usage: cut [-c list] [files...]"
print e1 > "/dev/stderr"
print e2 > "/dev/stderr"
exit 1
}
BEGIN \
{
FS = "\t" # default
OFS = FS
while ((c = getopt(ARGC, ARGV, "sf:c:d:")) != -1) {
if (c == "f") {
by_fields = 1
fieldlist = Optarg
} else if (c == "c") {
by_chars = 1
fieldlist = Optarg
OFS = ""
} else if (c == "d") {
if (length(Optarg) > 1) {
printf("Using first character of %s" \
" for delimiter\n", Optarg) > "/dev/stderr"
Optarg = substr(Optarg, 1, 1)
}
FS = Optarg
OFS = FS
if (FS == " ") # defeat awk semantics
FS = "[ ]"
} else if (c == "s")
suppress++
else
usage()
}
for (i = 1; i < Optind; i++)
ARGV[i] = ""
if (by_fields && by_chars)
usage()
if (by_fields == 0 && by_chars == 0)
by_fields = 1 # default
if (fieldlist == "") {
print "cut: needs list for -c or -f" > "/dev/stderr"
exit 1
}
if (by_fields)
set_fieldlist()
else
set_charlist()
}
function set_fieldlist( n, m, i, j, k, f, g)
{
n = split(fieldlist, f, ",")
j = 1 # index in flist
for (i = 1; i <= n; i++) {
if (index(f[i], "-") != 0) { # a range
m = split(f[i], g, "-")
if (m != 2 || g[1] >= g[2]) {
printf("bad field list: %s\n",
f[i]) > "/dev/stderr"
exit 1
}
for (k = g[1]; k <= g[2]; k++)
flist[j++] = k
} else
flist[j++] = f[i]
}
nfields = j - 1
}
function set_charlist( field, i, j, f, g, t,
filler, last, len)
{
field = 1 # count total fields
n = split(fieldlist, f, ",")
j = 1 # index in flist
for (i = 1; i <= n; i++) {
if (index(f[i], "-") != 0) { # range
m = split(f[i], g, "-")
if (m != 2 || g[1] >= g[2]) {
printf("bad character list: %s\n",
f[i]) > "/dev/stderr"
exit 1
}
len = g[2] - g[1] + 1
if (g[1] > 1) # compute length of filler
filler = g[1] - last - 1
else
filler = 0
if (filler)
t[field++] = filler
t[field++] = len # length of field
last = g[2]
flist[j++] = field - 1
} else {
if (f[i] > 1)
filler = f[i] - last - 1
else
filler = 0
if (filler)
t[field++] = filler
t[field++] = 1
last = f[i]
flist[j++] = field - 1
}
}
FIELDWIDTHS = join(t, 1, field - 1)
nfields = j - 1
}
{
if (by_fields && suppress && index($0, FS) != 0)
next
for (i = 1; i <= nfields; i++) {
if ($flist[i] != "") {
printf "%s", $flist[i]
if (i < nfields && $flist[i+1] != "")
printf "%s", OFS
}
}
print ""
}
prog/extract.awk 0000666 00000003324 15100053302 0007664 0 ustar 00 # extract.awk --- extract files and run programs
# from texinfo files
#
# Arnold Robbins, arnold@skeeve.com, Public Domain
# May 1993
# Revised September 2000
BEGIN { IGNORECASE = 1 }
/^@c(omment)?[ \t]+system/ \
{
if (NF < 3) {
e = (FILENAME ":" FNR)
e = (e ": badly formed `system' line")
print e > "/dev/stderr"
next
}
$1 = ""
$2 = ""
stat = system($0)
if (stat != 0) {
e = (FILENAME ":" FNR)
e = (e ": warning: system returned " stat)
print e > "/dev/stderr"
}
}
/^@c(omment)?[ \t]+file/ \
{
if (NF != 3) {
e = (FILENAME ":" FNR ": badly formed `file' line")
print e > "/dev/stderr"
next
}
if ($3 != curfile) {
if (curfile != "")
close(curfile)
curfile = $3
}
for (;;) {
if ((getline line) <= 0)
unexpected_eof()
if (line ~ /^@c(omment)?[ \t]+endfile/)
break
else if (line ~ /^@(end[ \t]+)?group/)
continue
else if (line ~ /^@c(omment+)?[ \t]+/)
continue
if (index(line, "@") == 0) {
print line > curfile
continue
}
n = split(line, a, "@")
# if a[1] == "", means leading @,
# don't add one back in.
for (i = 2; i <= n; i++) {
if (a[i] == "") { # was an @@
a[i] = "@"
if (a[i+1] == "")
i++
}
}
print join(a, 1, n, SUBSEP) > curfile
}
}
function unexpected_eof() {
printf("%s:%d: unexpected EOF or error\n",
FILENAME, FNR) > "/dev/stderr"
exit 1
}
END {
if (curfile)
close(curfile)
}
prog/id.awk 0000666 00000002607 15100053302 0006611 0 ustar 00 # id.awk --- implement id in awk
#
# Requires user and group library functions
#
# Arnold Robbins, arnold@skeeve.com, Public Domain
# May 1993
# Revised February 1996
# output is:
# uid=12(foo) euid=34(bar) gid=3(baz) \
# egid=5(blat) groups=9(nine),2(two),1(one)
BEGIN \
{
uid = PROCINFO["uid"]
euid = PROCINFO["euid"]
gid = PROCINFO["gid"]
egid = PROCINFO["egid"]
printf("uid=%d", uid)
pw = getpwuid(uid)
if (pw != "") {
split(pw, a, ":")
printf("(%s)", a[1])
}
if (euid != uid) {
printf(" euid=%d", euid)
pw = getpwuid(euid)
if (pw != "") {
split(pw, a, ":")
printf("(%s)", a[1])
}
}
printf(" gid=%d", gid)
pw = getgrgid(gid)
if (pw != "") {
split(pw, a, ":")
printf("(%s)", a[1])
}
if (egid != gid) {
printf(" egid=%d", egid)
pw = getgrgid(egid)
if (pw != "") {
split(pw, a, ":")
printf("(%s)", a[1])
}
}
for (i = 1; ("group" i) in PROCINFO; i++) {
if (i == 1)
printf(" groups=")
group = PROCINFO["group" i]
printf("%d", group)
pw = getgrgid(group)
if (pw != "") {
split(pw, a, ":")
printf("(%s)", a[1])
}
if (("group" (i+1)) in PROCINFO)
printf(",")
}
print ""
}
prog/translate.awk 0000666 00000002237 15100053302 0010211 0 ustar 00 # translate.awk --- do tr-like stuff
#
# Arnold Robbins, arnold@skeeve.com, Public Domain
# August 1989
# February 2009 - bug fix
# Bugs: does not handle things like: tr A-Z a-z, it has
# to be spelled out. However, if `to' is shorter than `from',
# the last character in `to' is used for the rest of `from'.
function stranslate(from, to, target, lf, lt, ltarget, t_ar, i, c,
result)
{
lf = length(from)
lt = length(to)
ltarget = length(target)
for (i = 1; i <= lt; i++)
t_ar[substr(from, i, 1)] = substr(to, i, 1)
if (lt < lf)
for (; i <= lf; i++)
t_ar[substr(from, i, 1)] = substr(to, lt, 1)
for (i = 1; i <= ltarget; i++) {
c = substr(target, i, 1)
if (c in t_ar)
c = t_ar[c]
result = result c
}
return result
}
function translate(from, to)
{
return $0 = stranslate(from, to, $0)
}
# main program
BEGIN {
if (ARGC < 3) {
print "usage: translate from to" > "/dev/stderr"
exit
}
FROM = ARGV[1]
TO = ARGV[2]
ARGC = 2
ARGV[1] = "-"
}
{
translate(FROM, TO)
print
}
network/protbase.request 0000666 00000000242 15100053302 0011455 0 ustar 00 PROGRAM blastn
DATALIB month
EXPECT 0.75
BEGIN
>GAWK310 the gawking gene GNU AWK
tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat
caccaccatggacagcaaa
network/urlchk.awk 0000666 00000002035 15100053302 0010222 0 ustar 00 BEGIN {
if (ARGC != 2) {
print "URLCHK - check if URLs have changed"
print "IN:\n the file with URLs as a command-line parameter"
print " file contains URL, old length, new length"
print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080"
print "OUT:\n same as file with URLs"
print "JK 02.03.1998"
exit
}
URLfile = ARGV[1]; ARGV[1] = ""
if (Proxy != "") Proxy = " -v Proxy=" Proxy
if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort
while ((getline < URLfile) > 0)
Length[$1] = $3 + 0
close(URLfile) # now, URLfile is read in and can be updated
GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk "
for (i in Length) {
GetThisHeader = GetHeader i " 2>&1"
while ((GetThisHeader | getline) > 0)
if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0
close(GetThisHeader)
print i, Length[i], NewLength > URLfile
if (Length[i] != NewLength) # report only changed URLs
print i, Length[i], NewLength
}
close(URLfile)
}
network/testserv.awk 0000666 00000000516 15100053302 0010613 0 ustar 00 BEGIN {
CGI_setup("GET",
"http://www.gnu.org/cgi-bin/foo?p1=stuff&p2=stuff%26junk" \
"&percent=a %25 sign",
"1.0")
for (i in MENU)
printf "MENU[\"%s\"] = %s\n", i, MENU[i]
for (i in PARAM)
printf "PARAM[\"%s\"] = %s\n", i, PARAM[i]
for (i in GETARG)
printf "GETARG[\"%s\"] = %s\n", i, GETARG[i]
}
network/protbase.result 0000666 00000001202 15100053302 0011300 0 ustar 00 Sequences producing significant alignments: (bits) Value
gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20
gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20
emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20
emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20
emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20
emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20
gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20
network/PostAgent.sh 0000666 00000000422 15100053302 0010464 0 ustar 00 #!/bin/sh
MobAg=/tmp/MobileAgent.$$
# direct script to mobile agent file
cat > $MobAg
# execute agent concurrently
gawk -f $MobAg $MobAg > /dev/null &
# HTTP header, terminator and body
gawk 'BEGIN { print "\r\nAgent started" }'
rm $MobAg # delete script file of agent
network/mobag.awk 0000666 00000005431 15100053302 0010022 0 ustar 00 BEGIN {
if (ARGC != 2) {
print "MOBAG - a simple mobile agent"
print "CALL:\n gawk -f mobag.awk mobag.awk"
print "IN:\n the name of this script as a command-line parameter"
print "PARAM:\n -v MyOrigin=myhost.com"
print "OUT:\n the result on stdout"
print "JK 29.03.1998 01.04.1998"
exit
}
if (MyOrigin == "") {
"uname -n" | getline MyOrigin
close("uname -n")
}
}
#ReadMySelf
/^function / { FUNC = $2 }
/^END/ || /^#ReadMySelf/ { FUNC = $1 }
FUNC != "" { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 }
(FUNC != "") && (/^}/ || /^#EndOfMySelf/) \
{ FUNC = "" }
#EndOfMySelf
function migrate(Destination, MobCode, Label) {
MOBVAR["Label"] = Label
MOBVAR["Destination"] = Destination
RS = ORS = "\r\n"
HttpService = "/inet/tcp/0/" Destination
for (i in MOBFUN)
MobCode = (MobCode "\n" MOBFUN[i])
MobCode = MobCode "\n\nBEGIN {"
for (i in MOBVAR)
MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"")
MobCode = MobCode "\n}\n"
print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService
print "Content-length:", length(MobCode) ORS |& HttpService
printf "%s", MobCode |& HttpService
while ((HttpService |& getline) > 0)
print $0
close(HttpService)
}
END {
if (ARGC != 2) exit # stop when called with wrong parameters
if (MyOrigin != "") # is this the originating host?
MyInit() # if so, initialize the application
else # we are on a host with migrated data
MyJob() # so we do our job
}
function MyInit() {
MOBVAR["MyOrigin"] = MyOrigin
MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80"
split(MOBVAR["Machines"], Machines) # which host is the first?
migrate(Machines[1], "", "") # go to the first host
while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result
print $0 # print result
close("/inet/tcp/8080/0/0")
}
function MyJob() {
# forget this host
sub(MOBVAR["Destination"], "", MOBVAR["Machines"])
MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":"
while (("who" | getline) > 0) # who is logged in?
MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0
close("who")
if (index(MOBVAR["Machines"], "/") > 0) { # any more machines to visit?
split(MOBVAR["Machines"], Machines) # which host is next?
migrate(Machines[1], "", "") # go there
} else { # no more machines
gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin
print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080"
close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080")
}
}
network/webgrab.awk 0000666 00000000271 15100053302 0010343 0 ustar 00 BEGIN { RS = "http://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" }
RT != "" {
command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \
" > doc" NR ".html")
print command
}
network/stoxdata.txt 0000666 00000000245 15100053303 0010620 0 ustar 00 Date,Open,High,Low,Close,Volume
9-Oct-00,22.75,22.75,21.375,22.375,7888500
6-Oct-00,23.8125,24.9375,21.5625,22,10701100
5-Oct-00,24.4375,24.625,23.125,23.50,5810300
network/coreserv.awk 0000666 00000006474 15100053303 0010576 0 ustar 00 # CGI Library and core of a web server
#
# Juergen Kahrs, Juergen.Kahrs@vr-web.de
# with Arnold Robbins, arnold@gnu.org
# September 2000
# Global arrays
# GETARG --- arguments to CGI GET command
# MENU --- menu items (path names)
# PARAM --- parameters of form x=y
# Optional variable MyHost contains host address
# Optional variable MyPort contains port number
# Needs TopHeader, TopDoc, TopFooter
# Sets MyPrefix, HttpService, Status, Reason
BEGIN {
if (MyHost == "") {
"uname -n" | getline MyHost
close("uname -n")
}
if (MyPort == 0) MyPort = 8080
HttpService = "/inet/tcp/" MyPort "/0/0"
MyPrefix = "http://" MyHost ":" MyPort
SetUpServer()
while ("awk" != "complex") {
# header lines are terminated this way
RS = ORS = "\r\n"
Status = 200 # this means OK
Reason = "OK"
Header = TopHeader
Document = TopDoc
Footer = TopFooter
if (GETARG["Method"] == "GET") {
HandleGET()
} else if (GETARG["Method"] == "HEAD") {
# not yet implemented
} else if (GETARG["Method"] != "") {
print "bad method", GETARG["Method"]
}
Prompt = Header Document Footer
print "HTTP/1.0", Status, Reason |& HttpService
print "Connection: Close" |& HttpService
print "Pragma: no-cache" |& HttpService
len = length(Prompt) + length(ORS)
print "Content-length:", len |& HttpService
print ORS Prompt |& HttpService
# ignore all the header lines
while ((HttpService |& getline) > 0)
continue
# stop talking to this client
close(HttpService)
# wait for new client request
HttpService |& getline
# do some logging
print systime(), strftime(), $0
CGI_setup($1, $2, $3)
}
}
function CGI_setup( method, uri, version, i)
{
delete GETARG
delete MENU
delete PARAM
GETARG["Method"] = method
GETARG["URI"] = uri
GETARG["Version"] = version
i = index(uri, "?")
if (i > 0) { # is there a "?" indicating a CGI request?
split(substr(uri, 1, i-1), MENU, "[/:]")
split(substr(uri, i+1), PARAM, "&")
for (i in PARAM) {
PARAM[i] = _CGI_decode(PARAM[i])
j = index(PARAM[i], "=")
GETARG[substr(PARAM[i], 1, j-1)] = \
substr(PARAM[i], j+1)
}
} else { # there is no "?", no need for splitting PARAMs
split(uri, MENU, "[/:]")
}
for (i in MENU) # decode characters in path
if (i > 4) # but not those in host name
MENU[i] = _CGI_decode(MENU[i])
}
function _CGI_decode(str, hexdigs, i, pre, code1, code2,
val, result)
{
hexdigs = "123456789abcdef"
i = index(str, "%")
if (i == 0) # no work to do
return str
do {
pre = substr(str, 1, i-1) # part before %xx
code1 = substr(str, i+1, 1) # first hex digit
code2 = substr(str, i+2, 1) # second hex digit
str = substr(str, i+3) # rest of string
code1 = tolower(code1)
code2 = tolower(code2)
val = index(hexdigs, code1) * 16 \
+ index(hexdigs, code2)
result = result pre sprintf("%c", val)
i = index(str, "%")
} while (i != 0)
if (length(str) > 0)
result = result str
return result
}
network/protbase.awk 0000666 00000000620 15100053303 0010550 0 ustar 00 { request = request "\n" $0 }
END {
BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80"
printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService
printf "Content-Length: " length(request) "\n\n" |& BLASTService
printf request |& BLASTService
while ((BLASTService |& getline) > 0)
print $0
close(BLASTService)
}
network/hello-serv.awk 0000666 00000000717 15100053303 0011020 0 ustar 00 BEGIN {
RS = ORS = "\r\n"
HttpService = "/inet/tcp/8080/0/0"
Hello = "" \
"A Famous Greeting" \
"Hello, world
"
Len = length(Hello) + length(ORS)
print "HTTP/1.0 200 OK" |& HttpService
print "Content-Length: " Len ORS |& HttpService
print Hello |& HttpService
while ((HttpService |& getline) > 0)
continue;
close(HttpService)
}
network/remconf.awk 0000666 00000004211 15100053303 0010362 0 ustar 00 function SetUpServer() {
TopHeader = "Remote Configuration"
TopDoc = "\
Please choose one of the following actions:
\
"
TopFooter = ""
if (ConfigFile == "") ConfigFile = "config.asc"
}
function HandleGET() {
if(MENU[2] == "AboutServer") {
Document = "This is a GUI for remote configuration of an\
embedded system. It is is implemented as one GAWK script."
} else if (MENU[2] == "ReadConfig") {
RS = "\n"
while ((getline < ConfigFile) > 0)
config[$1] = $2;
close(ConfigFile)
RS = "\r\n"
Document = "Configuration has been read."
} else if (MENU[2] == "CheckConfig") {
Document = ""
for (i in config)
Document = Document "| " i " | " \
"" config[i] " |
"
Document = Document "
"
} else if (MENU[2] == "ChangeConfig") {
if ("Param" in GETARG) { # any parameter to set?
if (GETARG["Param"] in config) { # is parameter valid?
config[GETARG["Param"]] = GETARG["Value"]
Document = (GETARG["Param"] " = " GETARG["Value"] ".")
} else {
Document = "Parameter " GETARG["Param"] " is invalid."
}
} else {
Document = ""
}
} else if (MENU[2] == "SaveConfig") {
for (i in config)
printf("%s %s\n", i, config[i]) > ConfigFile
close(ConfigFile)
Document = "Configuration has been saved."
}
}
network/geturl.awk 0000666 00000001423 15100053303 0010235 0 ustar 00 BEGIN {
if (ARGC != 2) {
print "GETURL - retrieve Web page via HTTP 1.0"
print "IN:\n the URL as a command-line parameter"
print "PARAM(S):\n -v Proxy=MyProxy"
print "OUT:\n the page content on stdout"
print " the page header on stderr"
print "JK 16.05.1997"
print "ADR 13.08.2000"
exit
}
URL = ARGV[1]; ARGV[1] = ""
if (Proxy == "") Proxy = "127.0.0.1"
if (ProxyPort == 0) ProxyPort = 80
if (Method == "") Method = "GET"
HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort
ORS = RS = "\r\n\r\n"
print Method " " URL " HTTP/1.0" |& HttpService
HttpService |& getline Header
print Header > "/dev/stderr"
while ((HttpService |& getline) > 0)
printf "%s", $0
close(HttpService)
}
network/maze.awk 0000666 00000005140 15100053303 0007667 0 ustar 00 function SetUpServer() {
TopHeader = "Walk through a maze"
TopDoc = "\
Please choose one of the following actions:
\
"
TopFooter = ""
srand()
}
function HandleGET() {
if (MENU[2] == "AboutServer") {
Document = "If your browser has a VRML 2 plugin,\
this server shows you a simple VRML scene."
} else if (MENU[2] == "VRMLtest") {
XSIZE = YSIZE = 11 # initially, everything is wall
for (y = 0; y < YSIZE; y++)
for (x = 0; x < XSIZE; x++)
Maze[x, y] = "#"
delete Maze[0, 1] # entry is not wall
delete Maze[XSIZE-1, YSIZE-2] # exit is not wall
MakeMaze(1, 1)
Document = "\
#VRML V2.0 utf8\n\
Group {\n\
children [\n\
PointLight {\n\
ambientIntensity 0.2\n\
color 0.7 0.7 0.7\n\
location 0.0 8.0 10.0\n\
}\n\
DEF B1 Background {\n\
skyColor [0 0 0, 1.0 1.0 1.0 ]\n\
skyAngle 1.6\n\
groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\
groundAngle [ 1.2 1.57 ]\n\
}\n\
DEF Wall Shape {\n\
geometry Box {size 1 1 1}\n\
appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\
}\n\
DEF Entry Viewpoint {\n\
position 0.5 1.0 5.0\n\
orientation 0.0 0.0 -1.0 0.52\n\
}\n"
for (i in Maze) {
split(i, t, SUBSEP)
Document = Document " Transform { translation "
Document = Document t[1] " 0 -" t[2] " children USE Wall }\n"
}
Document = Document " ] # end of group for world\n}"
Reason = "OK" ORS "Content-type: model/vrml"
Header = Footer = ""
}
}
function MakeMaze(x, y) {
delete Maze[x, y] # here we are, we have no wall here
p = 0 # count unvisited fields in all directions
if (x-2 SUBSEP y in Maze) d[p++] = "-x"
if (x SUBSEP y-2 in Maze) d[p++] = "-y"
if (x+2 SUBSEP y in Maze) d[p++] = "+x"
if (x SUBSEP y+2 in Maze) d[p++] = "+y"
if (p>0) { # if there are univisited fields, go there
p = int(p*rand()) # choose one unvisited field at random
if (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y)
} else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2)
} else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y)
} else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2)
} # we are back from recursion
MakeMaze(x, y); # try again while there are unvisited fields
}
}
network/statist.awk 0000666 00000007033 15100053303 0010431 0 ustar 00 function SetUpServer() {
TopHeader = "Statistics with GAWK"
TopDoc = "\
Please choose one of the following actions:
\
"
TopFooter = ""
GnuPlot = "gnuplot 2>&1"
m1=m2=0; v1=v2=1; n1=n2=10
}
function HandleGET() {
if(MENU[2] == "AboutServer") {
Document = "This is a GUI for a statistical computation.\
It compares means and variances of two distributions.\
It is implemented as one GAWK script and uses GNUPLOT."
} else if (MENU[2] == "EnterParameters") {
Document = ""
if ("m1" in GETARG) { # are there parameters to compare?
Document = Document ""
m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"]
m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"]
t = (m1-m2)/sqrt(v1/n1+v2/n2)
df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \
+ (v2/n2)*(v2/n2) /(n2-1))
if (v1>v2) {
f = v1/v2
df1 = n1 - 1
df2 = n2 - 1
} else {
f = v2/v1
df1 = n2 - 1
df2 = n1 - 1
}
print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot
print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \
df2/(df2+df1*f) ")" |& GnuPlot
print "print pt, pF" |& GnuPlot
RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF
print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot
print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot
print "set term png small color" |& GnuPlot
#print "set term postscript color" |& GnuPlot
#print "set term gif medium size 320,240" |& GnuPlot
print "set yrange[-0.3:]" |& GnuPlot
print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot
print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot
print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\
mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot
print "quit" |& GnuPlot
GnuPlot |& getline Image
while ((GnuPlot |& getline) > 0)
Image = Image RS $0
close(GnuPlot)
}
Document = Document "\
Do these samples have the same Gaussian distribution?
\
"
} else if (MENU[2] ~ "Image") {
Reason = "OK" ORS "Content-type: image/png"
#Reason = "OK" ORS "Content-type: application/x-postscript"
#Reason = "OK" ORS "Content-type: image/gif"
Header = Footer = ""
Document = Image
}
}
network/fingerclient.awk 0000666 00000000241 15100053303 0011401 0 ustar 00 BEGIN {
NetService = "/inet/tcp/0/localhost/finger"
print "var{name}" |& NetService
while ((NetService |& getline) > 0)
print $0
close(NetService)
}
network/eliza.awk.gz 0000666 00000007503 15100053303 0010463 0 ustar 00 Z{sߟYl$l;2Ƞ$"8td0
YX$BN{Ϲ/]v';/)~٭2^CMm3'j
M?=G[G M;]ZC? GO$z=I7/vSqv߶7 Zi|X4Z&z,p熶m 0_̶I^/٬.M
^w7|d= !i O8 a Vϐy
IHdǾf\EEWLCv~=Mwr !^cAglN2/C )OА)pk09v(,T:NѠNρd]n+LI0["M7EDaa-:#V+rr
Q'u=J :K#M ~D*[vh_' thEve9a*+g8ؒ;&
z9Po~6R;٬/)_fN
WD o8b!,TWDUתXwb}ӵDE4^5`>`:ki"! L|3-i1#P0
`6j2.ku`o @uK֛Dt~>jзHINfҚCNq jM%'R BP<.1Z_) lX[ [6ql8б\_ ,hG߷F#ƃ.>3#`|?9WEp1j KZ=%')A̺ } ֽņ}|z!R
%P7FyOLu+owᓿ3DmN缔4yt|X̩n(-Osa"% Yf3CqJ*'+IB0@Prڽv# Q5rT" 9!.PwGfkzG|`F
`>̲J:D\n^qC>.зþWH,#o!sGQSF_=kwh8\ >>0_2~;XD70M[+k;yTrz fEq[сc¨VfWA̕JzPf oք;
+Bs@ؑѡзSᬕ 5ENd͂,GSL
,Dν\XkU-Dy%CgԒ :{X#o*Akw lh iɰ@RJ)M$MZ8pkI+22]q)<9i.&{<5ٖ*ؿ
"A/D
_ ca4m@ $~ (kY#$ 8> >- $e#ӌn29dW[&Xt>HkP!0uQ5*9zt n
{x`H|"F49ҡ rļdÄ`RaaqHO2O=%')$YИqEhz+=F6,βH$s"MoYAJvi1TYK{5ߧ=n^3F?w3GtFǃ˯_$d)M(C:V& T8;d,uh@Z?*(RhiYhh
TY.lz$(P6ŭ ]s\rUe 1kPCar^f T ZtV(T0d WjPC&T2 8ps&" \
"This site is temporarily out of service." \
"